Cherry SNP DataBase

Gene information

Gene Pav_sc0003492.1_g370.1.mk
Chromosome name PAV_r1.0chr4
start 13083119
end 13088196
PAV_r1.0 name Pav_sc0003492.1
start 178265
end 183342
direction +
Annotation NR PREDICTED: 28 kDa heat- and acid-stable phosphoprotein-like
Sequence CDS ATGGGAAGAGGAAAGTTCAAGGGCAAGCCCACCGGTCACCGCCACTTCTCCACCCACGAA GAGATGGTTGCTGGTACCTCTGCTCGTCCACGTAGTTTTAAAAGGGAAGAAGCTGAAGAG GAGGAAGAAGTAGAGTCTGAAGAGGAATCATCAGAAGAAGAAGAATCTGAAATTGAGAAA ACTTCGGAGCTCTCAAGGCAACGCTTAGCCCTGATTCGCCAACAAAGGGCAGAAGCCGCT AAGAAGCGAGAAGAAGAAAAGGCTGCCAGGGACCAGAAAAAAGGCGAGGGACGCAAGTGA
PEP MGRGKFKGKPTGHRHFSTHEEMVAGTSARPRSFKREEAEEEEEVESEEESSEEEESEIEK TSELSRQRLALIRQQRAEAAKKREEEKAARDQKKGEGRK


| Top |