Cherry SNP DataBase

SSR information

Name MA053a
Chr
Pos (Chr)
PAV_r1.0
Pos (PAV_r1.0)
REF
ALT
SSR motif
Gene Name
Annotation
snpEff Effect
Impact
Codon
Amino Acid
PCR Forward primer TCACTCTCCAGTAAACACTATG
Reverse primer AGCCACTACAATGATAGCAA
Product size
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References AB206848


| Top |