Cherry SNP DataBase

SNP information

Name Pav_sc0000009.1_329070R
Chr PAV_r1.0chr3
Pos (Chr) 20297528
PAV_r1.0 Pav_sc0000009.1
Pos (PAV_r1.0) 329070
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.329070A>G
Amino Acid
PCR Forward primer CCATTGGCTTGGCAATAAAT
Reverse primer GTCCCAAGTCTCACTGGCTC
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |