Cherry SNP DataBase

SNP information

Name Pav_sc0000012.1_135639M
Chr PAV_r1.0chr2
Pos (Chr) 10829305
PAV_r1.0 Pav_sc0000012.1
Pos (PAV_r1.0) 135639
REF C
ALT A
SSR motif
Gene Name Pav_sc0000012.1_g250.1.mk
Annotation PREDICTED: uncharacterized protein LOC103331342
snpEff Effect missense_variant
Impact MODERATE
Codon c.1302G>T
Amino Acid p.Leu434Phe
PCR Forward primer TGCAGAAAACACAAAGCCAG
Reverse primer CGGAATTCCTGCGTGAGTAT
Product size 256
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |