Cherry SNP DataBase

SNP information

Name Pav_sc0000012.1_176760R
Chr PAV_r1.0chr2
Pos (Chr) 10870426
PAV_r1.0 Pav_sc0000012.1
Pos (PAV_r1.0) 176760
REF A
ALT G
SSR motif
Gene Name Pav_sc0000012.1_g360.1.mk
Annotation hypothetical protein PRUPE_ppa000047mg
snpEff Effect missense_variant
Impact MODERATE
Codon c.2789A>G
Amino Acid p.Gln930Arg
PCR Forward primer TTCAAATTCTGCTCGAGGCT
Reverse primer AGCGGATCCTAATGCAATGT
Product size 320
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |