Cherry SNP DataBase

SNP information

Name Pav_sc0000017.1_467291M
Chr PAV_r1.0chr1
Pos (Chr) 12089386
PAV_r1.0 Pav_sc0000017.1
Pos (PAV_r1.0) 467291
REF C
ALT A
SSR motif
Gene Name Pav_sc0000017.1_g720.1.mk
Annotation PREDICTED: TATA box-binding protein-associated factor RNA polymerase I subunit B
snpEff Effect 5_prime_UTR_variant
Impact MODIFIER
Codon c.-307C>A
Amino Acid
PCR Forward primer CGCTCCGTCTCTGTCTCTCT
Reverse primer TGAAGGCGTGTGTGTGAAAT
Product size 291
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |