Cherry SNP DataBase

SNP information

Name Pav_sc0000017.1_71167Y
Chr PAV_r1.0chr1
Pos (Chr) 11693262
PAV_r1.0 Pav_sc0000017.1
Pos (PAV_r1.0) 71167
REF C
ALT T
SSR motif
Gene Name Pav_sc0000017.1_g140.1.mk
Annotation PREDICTED: 3-phosphoshikimate 1-carboxyvinyltransferase 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.259-86G>A
Amino Acid
PCR Forward primer TTTGCCTTGTCCTCTTCCAC
Reverse primer TGGTGGATCGGAAACTCTTT
Product size 280
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |