Cherry SNP DataBase

SNP information

Name Pav_sc0000023.1_342228W
Chr PAV_r1.0chr3
Pos (Chr) 18917490
PAV_r1.0 Pav_sc0000023.1
Pos (PAV_r1.0) 342228
REF T
ALT A
SSR motif
Gene Name Pav_sc0000023.1_g700.1.mk
Annotation PREDICTED: phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN
snpEff Effect intron_variant
Impact MODIFIER
Codon c.280-60T>A
Amino Acid
PCR Forward primer CCTCTCTGGCAGGTCAAGTC
Reverse primer CTCCACGCGACCATAAAAAT
Product size 238
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |