Cherry SNP DataBase

SNP information

Name Pav_sc0000026.1_157452W
Chr PAV_r1.0chr2
Pos (Chr) 13092341
PAV_r1.0 Pav_sc0000026.1
Pos (PAV_r1.0) 157452
REF T
ALT A
SSR motif
Gene Name Pav_sc0000026.1_g230.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC103331707
snpEff Effect intron_variant
Impact MODIFIER
Codon c.847-119A>T
Amino Acid
PCR Forward primer CATTTCATCCCCCACTTCAC
Reverse primer GGGAAAATCAGCGAAACCTT
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |