Cherry SNP DataBase

SNP information

Name Pav_sc0000029.1_130303M
Chr PAV_r1.0chr4
Pos (Chr) 14189237
PAV_r1.0 Pav_sc0000029.1
Pos (PAV_r1.0) 130303
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.130303A>C
Amino Acid
PCR Forward primer GATCTCCCAAAACCACGGTA
Reverse primer TGTGTGGTCAAGAGGTGCTT
Product size 333
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |