Cherry SNP DataBase

SNP information

Name Pav_sc0000029.1_17219M
Chr PAV_r1.0chr4
Pos (Chr) 14076153
PAV_r1.0 Pav_sc0000029.1
Pos (PAV_r1.0) 17219
REF A
ALT C
SSR motif
Gene Name Pav_sc0000029.1_g030.1.mk
Annotation PREDICTED: ultraviolet-B receptor UVR8 isoform X1
snpEff Effect missense_variant
Impact MODERATE
Codon c.556T>G
Amino Acid p.Cys186Gly
PCR Forward primer CCACAGTAGCCTTTACCCCA
Reverse primer CGAACTCCAAAGCTTTCTGC
Product size 247
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT


| Top |