Cherry SNP DataBase

SNP information

Name Pav_sc0000042.1_318937M
Chr PAV_r1.0chr5
Pos (Chr) 11177737
PAV_r1.0 Pav_sc0000042.1
Pos (PAV_r1.0) 318937
REF A
ALT C
SSR motif
Gene Name Pav_sc0000042.1_g530.1.mk
Annotation PREDICTED: protein MEI2-like 1 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1807+171A>C
Amino Acid
PCR Forward primer ACAGACAGAAGGCCCACTTG
Reverse primer CTCCGAGAAAGGATAAGGGG
Product size 339
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT REF/ALT


| Top |