Cherry SNP DataBase

SNP information

Name Pav_sc0000045.1_266882K
Chr PAV_r1.0chr1
Pos (Chr) 274505
PAV_r1.0 Pav_sc0000045.1
Pos (PAV_r1.0) 266882
REF G
ALT T
SSR motif
Gene Name Pav_sc0000045.1_g450.1.br
Annotation
snpEff Effect missense_variant
Impact MODERATE
Codon c.136G>T
Amino Acid p.Ala46Ser
PCR Forward primer TATCCATCTTCCCCAACCAA
Reverse primer ACCGAGGGCTAGAGAGAAGG
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/REF


| Top |