Cherry SNP DataBase

SNP information

Name Pav_sc0000052.1_113965M
Chr PAV_r1.0chr4
Pos (Chr) 20981838
PAV_r1.0 Pav_sc0000052.1
Pos (PAV_r1.0) 113965
REF A
ALT C
SSR motif
Gene Name Pav_sc0000052.1_g340.1.mk
Annotation PREDICTED: 1-acyl-sn-glycerol-3-phosphate acyltransferase 3-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.244+76A>C
Amino Acid
PCR Forward primer TTCTGCTGCAGGTTGAGTTG
Reverse primer GTGATTGCAAATGACAAGCG
Product size 239
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/REF


| Top |