Cherry SNP DataBase

SNP information

Name Pav_sc0000065.1_602851K
Chr PAV_r1.0chr1
Pos (Chr) 6069578
PAV_r1.0 Pav_sc0000065.1
Pos (PAV_r1.0) 602851
REF G
ALT T
SSR motif
Gene Name Pav_sc0000065.1_g840.1.mk
Annotation PREDICTED: putative GDP-L-fucose synthase 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.19+192C>A
Amino Acid
PCR Forward primer GACGAGGTTGGTGAACCCTA
Reverse primer CGCCATTGACGGTACTCTCT
Product size 321
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |