Cherry SNP DataBase

SNP information

Name Pav_sc0000067.1_170167S
Chr PAV_r1.0chr3
Pos (Chr) 8657590
PAV_r1.0 Pav_sc0000067.1
Pos (PAV_r1.0) 170167
REF C
ALT G
SSR motif
Gene Name Pav_sc0000067.1_g330.1.mk
Annotation PREDICTED: uncharacterized protein LOC103328503 isoform X2
snpEff Effect missense_variant
Impact MODERATE
Codon c.580G>C
Amino Acid p.Asp194His
PCR Forward primer TGCTCTTGCAAAAGTGGTTG
Reverse primer GGGTATTGCTGGTTCAGACG
Product size 270
Enzymes for CAPS EcoRV | XbaI
Exp. fragment size (REF) 155,115 | 157,113
Exp. fragment size (ALT) 270 | 270
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |