Cherry SNP DataBase

SNP information

Name Pav_sc0000069.1_28735R
Chr PAV_r1.0chr1
Pos (Chr) 30468903
PAV_r1.0 Pav_sc0000069.1
Pos (PAV_r1.0) 28735
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.28735A>G
Amino Acid
PCR Forward primer CACGTGAACCGCAATACATC
Reverse primer TTTCACCATTCCTTGATGGC
Product size 217
Enzymes for CAPS AfaI
Exp. fragment size (REF) 126,12,79
Exp. fragment size (ALT) 138,79
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT -/- REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |