Cherry SNP DataBase

SNP information

Name Pav_sc0000071.1_378364R
Chr PAV_r1.0chr7
Pos (Chr) 12024638
PAV_r1.0 Pav_sc0000071.1
Pos (PAV_r1.0) 378364
REF A
ALT G
SSR motif
Gene Name Pav_sc0000071.1_g780.1.mk
Annotation PREDICTED: eukaryotic initiation factor 4A isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.249+54A>G
Amino Acid
PCR Forward primer AATTGGGCAGGAGACATTGA
Reverse primer TGCTCCAAAACTTATGCCCT
Product size 302
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |