Cherry SNP DataBase

SNP information

Name Pav_sc0000072.1_58050M
Chr PAV_r1.0chr2
Pos (Chr) 13768649
PAV_r1.0 Pav_sc0000072.1
Pos (PAV_r1.0) 58050
REF C
ALT A
SSR motif
Gene Name Pav_sc0000072.1_g110.1.mk
Annotation PREDICTED: 65-kDa microtubule-associated protein 9
snpEff Effect intron_variant
Impact MODIFIER
Codon c.529-47G>T
Amino Acid
PCR Forward primer CCATTACCAGATTCACACGG
Reverse primer GAATCCATGCATAGCTGGAAG
Product size 328
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |