Cherry SNP DataBase

SNP information

Name Pav_sc0000072.1_66740R
Chr PAV_r1.0chr2
Pos (Chr) 13777339
PAV_r1.0 Pav_sc0000072.1
Pos (PAV_r1.0) 66740
REF G
ALT A
SSR motif
Gene Name Pav_sc0000072.1_g140.1.mk
Annotation PREDICTED: uncharacterized protein LOC103331798
snpEff Effect synonymous_variant
Impact LOW
Codon c.768G>A
Amino Acid p.Ser256Ser
PCR Forward primer TGAAACACTTGGCGTTGAAG
Reverse primer CCACCTTATGCTTAGCAGCC
Product size 249
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |