Cherry SNP DataBase

SNP information

Name Pav_sc0000084.1_218865W
Chr PAV_r1.0chr2
Pos (Chr) 18579255
PAV_r1.0 Pav_sc0000084.1
Pos (PAV_r1.0) 218865
REF T
ALT A
SSR motif
Gene Name Pav_sc0000084.1_g400.1.mk
Annotation PREDICTED: endoplasmic reticulum metallopeptidase 1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.916-104T>A
Amino Acid
PCR Forward primer ATCTGCTTTTGAAGACGGGA
Reverse primer TGCTCTGGCCCTTATTATCC
Product size 327
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |