Cherry SNP DataBase

SNP information

Name Pav_sc0000084.1_415087R
Chr PAV_r1.0chr2
Pos (Chr) 18383033
PAV_r1.0 Pav_sc0000084.1
Pos (PAV_r1.0) 415087
REF A
ALT G
SSR motif
Gene Name Pav_sc0000084.1_g730.1.mk
Annotation PREDICTED: ATPase ASNA1 homolog
snpEff Effect missense_variant
Impact MODERATE
Codon c.1024A>G
Amino Acid p.Ser342Gly
PCR Forward primer CCACGCTTGTGTTCGATTTA
Reverse primer CCTAGAAATCTAAGGGCGGG
Product size 215
Enzymes for CAPS HaeIII | MspI
Exp. fragment size (REF) 215 | 123,92
Exp. fragment size (ALT) 146,69 | 123,20,72
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |