Cherry SNP DataBase

SNP information

Name Pav_sc0000085.1_30406R
Chr PAV_r1.0chr1
Pos (Chr) 27731265
PAV_r1.0 Pav_sc0000085.1
Pos (PAV_r1.0) 30406
REF A
ALT G
SSR motif
Gene Name Pav_sc0000085.1_g120.1.mk
Annotation PREDICTED: calcium-dependent protein kinase 29
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2542+144T>C
Amino Acid
PCR Forward primer CGCATTCATCATTGACTTGG
Reverse primer AGCCTGGCTTATTTCTGCAA
Product size 269
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT REF/REF ALT/ALT REF/ALT


| Top |