Cherry SNP DataBase

SNP information

Name Pav_sc0000085.1_40571Y
Chr PAV_r1.0chr1
Pos (Chr) 27741430
PAV_r1.0 Pav_sc0000085.1
Pos (PAV_r1.0) 40571
REF T
ALT C
SSR motif
Gene Name Pav_sc0000085.1_g130.1.mk
Annotation hypothetical protein PRUPE_ppa009562mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.264-20T>C
Amino Acid
PCR Forward primer CTGCCCATTTGTCTGTCAAC
Reverse primer CTAATCAGCGCAGCAAATGA
Product size 290
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF REF/ALT


| Top |