Cherry SNP DataBase

SNP information

Name Pav_sc0000091.1_235517S
Chr PAV_r1.0chr1
Pos (Chr) 18284403
PAV_r1.0 Pav_sc0000091.1
Pos (PAV_r1.0) 235517
REF C
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.235517C>G
Amino Acid
PCR Forward primer AAAATTCCAAAATCCCCAGC
Reverse primer CATGAACGATTTGACGAGGA
Product size 289
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |