Cherry SNP DataBase

SNP information

Name Pav_sc0000093.1_194101W
Chr PAV_r1.0chr8
Pos (Chr) 9298098
PAV_r1.0 Pav_sc0000093.1
Pos (PAV_r1.0) 194101
REF T
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.194101T>A
Amino Acid
PCR Forward primer TCAATTTCCAGCATCCCACT
Reverse primer CGACTGATTTCGCAAAGGAT
Product size 260
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/ALT


| Top |