Cherry SNP DataBase

SNP information

Name Pav_sc0000094.1_671581R
Chr PAV_r1.0chr6
Pos (Chr) 6165801
PAV_r1.0 Pav_sc0000094.1
Pos (PAV_r1.0) 671581
REF G
ALT A
SSR motif
Gene Name Pav_sc0000094.1_g1210.1.mk
Annotation PREDICTED: uncharacterized protein LOC103324350
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1202-88C>T
Amino Acid
PCR Forward primer CGGAGTCTAGAGTTTTGGCG
Reverse primer CAGAAGACACGTGGCTGAAA
Product size 286
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |