Cherry SNP DataBase

SNP information

Name Pav_sc0000095.1_26546W
Chr PAV_r1.0chr4
Pos (Chr) 10481736
PAV_r1.0 Pav_sc0000095.1
Pos (PAV_r1.0) 26546
REF T
ALT A
SSR motif
Gene Name Pav_sc0000095.1_g100.1.br
Annotation PREDICTED: BAHD acyltransferase At5g47980-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.564T>A
Amino Acid p.His188Gln
PCR Forward primer TGGGATGGCAATTGTAGTCA
Reverse primer TTGGAGGCATCAAACACAAA
Product size 246
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |