Cherry SNP DataBase

SNP information

Name Pav_sc0000095.1_452814M
Chr PAV_r1.0chr4
Pos (Chr) 10908004
PAV_r1.0 Pav_sc0000095.1
Pos (PAV_r1.0) 452814
REF C
ALT A
SSR motif
Gene Name Pav_sc0000095.1_g890.1.mk
Annotation PREDICTED: ubiquitin carboxyl-terminal hydrolase 25
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2199+268G>T
Amino Acid
PCR Forward primer CACTCAAATCAGCAAGCCAA
Reverse primer TGGCCAGTCCATGTTGTTTA
Product size 248
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT ALT/ALT REF/REF REF/REF


| Top |