Cherry SNP DataBase

SNP information

Name Pav_sc0000096.1_350160R
Chr PAV_r1.0chr7
Pos (Chr) 3844720
PAV_r1.0 Pav_sc0000096.1
Pos (PAV_r1.0) 350160
REF G
ALT A
SSR motif
Gene Name Pav_sc0000096.1_g570.1.mk
Annotation PREDICTED: uncharacterized protein At2g39795, mitochondrial isoform X1
snpEff Effect 5_prime_UTR_premature_start_codon_gain_variant
Impact LOW
Codon c.-17C>T
Amino Acid
PCR Forward primer CAGGAAAGCCCATGTTGAAT
Reverse primer CTGGTCCAGGAGAGCAAAAG
Product size 241
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT ALT/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |