Cherry SNP DataBase

SNP information

Name Pav_sc0000099.1_214330Y
Chr PAV_r1.0chr7
Pos (Chr) 13483109
PAV_r1.0 Pav_sc0000099.1
Pos (PAV_r1.0) 214330
REF C
ALT T
SSR motif
Gene Name Pav_sc0000099.1_g520.1.mk
Annotation PREDICTED: GTP-binding protein ERG
snpEff Effect synonymous_variant
Impact LOW
Codon c.1455G>A
Amino Acid p.Ser485Ser
PCR Forward primer GGCATAGGGTCAGGTTGCTA
Reverse primer TTTCATGTAGAGCTGGCACG
Product size 219
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF ALT/ALT REF/ALT REF/REF


| Top |