Cherry SNP DataBase

SNP information

Name Pav_sc0000103.1_568489W
Chr PAV_r1.0chr5
Pos (Chr) 16505945
PAV_r1.0 Pav_sc0000103.1
Pos (PAV_r1.0) 568489
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.568489A>T
Amino Acid
PCR Forward primer GTGTAGCAGCAGCAGCAGAG
Reverse primer TGACACTCCAACAAAGCCTG
Product size 310
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |