Cherry SNP DataBase

SNP information

Name Pav_sc0000103.1_90750Y
Chr PAV_r1.0chr5
Pos (Chr) 16028206
PAV_r1.0 Pav_sc0000103.1
Pos (PAV_r1.0) 90750
REF T
ALT C
SSR motif
Gene Name Pav_sc0000103.1_g220.1.mk
Annotation PREDICTED: uncharacterized protein LOC103338739
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*173-173A>G
Amino Acid
PCR Forward primer GCTGCAGAAAGGAACATCAA
Reverse primer AACGAATTTGATCCAACGGT
Product size 272
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |