Cherry SNP DataBase

SNP information

Name Pav_sc0000103.1_923592W
Chr PAV_r1.0chr5
Pos (Chr) 16861048
PAV_r1.0 Pav_sc0000103.1
Pos (PAV_r1.0) 923592
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.923592A>T
Amino Acid
PCR Forward primer GGTTGTCTGGCGGAGTTAGA
Reverse primer CATGATGCTGTTGGTTTTGC
Product size 299
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT ALT/ALT REF/ALT ALT/ALT REF/REF REF/ALT


| Top |