Cherry SNP DataBase

SNP information

Name Pav_sc0000107.1_13292W
Chr PAV_r1.0chr5
Pos (Chr) 7471293
PAV_r1.0 Pav_sc0000107.1
Pos (PAV_r1.0) 13292
REF T
ALT A
SSR motif
Gene Name Pav_sc0000107.1_g020.1.mk
Annotation PREDICTED: YTH domain-containing protein 1
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*144A>T
Amino Acid
PCR Forward primer CCAGCATCTGAGCAAGTCAA
Reverse primer CTGTGACTTCCCTTGGTCGT
Product size 347
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |