Cherry SNP DataBase

SNP information

Name Pav_sc0000107.1_9587R
Chr PAV_r1.0chr5
Pos (Chr) 7467588
PAV_r1.0 Pav_sc0000107.1
Pos (PAV_r1.0) 9587
REF A
ALT G
SSR motif
Gene Name Pav_sc0000107.1_g010.1.mk
Annotation hypothetical protein PRUPE_ppa010761mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*450-33T>C
Amino Acid
PCR Forward primer TCAGTGGAATTGCAGCTTTG
Reverse primer GTCTTTGTAGCCCAAGCCAC
Product size 257
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |