Cherry SNP DataBase

SNP information

Name Pav_sc0000120.1_107962W
Chr PAV_r1.0chr2
Pos (Chr) 12770517
PAV_r1.0 Pav_sc0000120.1
Pos (PAV_r1.0) 107962
REF T
ALT A
SSR motif
Gene Name Pav_sc0000120.1_g170.1.mk
Annotation hypothetical protein PRUPE_ppa012604mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.341-62T>A
Amino Acid
PCR Forward primer ACAGCTCATGAACTCGCAGA
Reverse primer ACTTCATCACACCCGGAGAG
Product size 282
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT REF/REF REF/ALT REF/ALT


| Top |