Cherry SNP DataBase

SNP information

Name Pav_sc0000130.1_81418R
Chr PAV_r1.0chr8
Pos (Chr) 20687939
PAV_r1.0 Pav_sc0000130.1
Pos (PAV_r1.0) 81418
REF G
ALT A
SSR motif
Gene Name Pav_sc0000130.1_g090.1.mk
Annotation PREDICTED: bromodomain and WD repeat-containing protein 3-like
snpEff Effect splice_donor_variant&intron_variant
Impact HIGH
Codon c.411+1G>A
Amino Acid
PCR Forward primer TGCAATGCAAAGCACCTAAA
Reverse primer CCTTGGTCTGAAAAGCGTTC
Product size 250
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/REF REF/ALT


| Top |