Cherry SNP DataBase

SNP information

Name Pav_sc0000138.1_302282R
Chr PAV_r1.0chr2
Pos (Chr) 24617137
PAV_r1.0 Pav_sc0000138.1
Pos (PAV_r1.0) 302282
REF G
ALT A
SSR motif
Gene Name Pav_sc0000138.1_g700.1.mk
Annotation PREDICTED: LAG1 longevity assurance homolog 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.229-427C>T
Amino Acid
PCR Forward primer CTCCTCAACTGCAGGAGCA
Reverse primer TGAGTTTGAACCCTCATTTGG
Product size 259
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |