Cherry SNP DataBase

SNP information

Name Pav_sc0000142.1_68722K
Chr PAV_r1.0chr6
Pos (Chr) 15398698
PAV_r1.0 Pav_sc0000142.1
Pos (PAV_r1.0) 68722
REF G
ALT T
SSR motif
Gene Name Pav_sc0000142.1_g120.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At5g67570, chloroplastic
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1999-118C>A
Amino Acid
PCR Forward primer CAACCTGCAGGCAGATAGGT
Reverse primer ATTTGTGGAGTGAGGCGTTC
Product size 315
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |