Cherry SNP DataBase

SNP information

Name Pav_sc0000148.1_81996Y
Chr PAV_r1.0chr2
Pos (Chr) 4530157
PAV_r1.0 Pav_sc0000148.1
Pos (PAV_r1.0) 81996
REF C
ALT T
SSR motif
Gene Name Pav_sc0000148.1_g180.1.mk
Annotation hypothetical protein PRUPE_ppa015501mg
snpEff Effect missense_variant
Impact MODERATE
Codon c.802G>A
Amino Acid p.Val268Ile
PCR Forward primer GCCTTTGCTGCTCTTGTTTT
Reverse primer GATTCCATTGCTCCTCCTGA
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/REF


| Top |