Cherry SNP DataBase

SNP information

Name Pav_sc0000157.1_107224R
Chr PAV_r1.0chr3
Pos (Chr) 14912910
PAV_r1.0 Pav_sc0000157.1
Pos (PAV_r1.0) 107224
REF G
ALT A
SSR motif
Gene Name Pav_sc0000157.1_g180.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At5g65560-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.315C>T
Amino Acid p.Ser105Ser
PCR Forward primer AAAATCCTCACACGGTCTGC
Reverse primer TCCCAACTCTCTCATCCACC
Product size 299
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/ALT


| Top |