Cherry SNP DataBase

SNP information

Name Pav_sc0000158.1_119245K
Chr PAV_r1.0chr3
Pos (Chr) 900171
PAV_r1.0 Pav_sc0000158.1
Pos (PAV_r1.0) 119245
REF T
ALT G
SSR motif
Gene Name Pav_sc0000158.1_g220.1.mk
Annotation PREDICTED: uncharacterized protein LOC103327444 isoform X1
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.835-5T>G
Amino Acid
PCR Forward primer GCACAAGCTCAACTAATTCGC
Reverse primer AAAGGATTTTTAAGCACCATGC
Product size 345
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |