Cherry SNP DataBase

SNP information

Name Pav_sc0000158.1_8382Y
Chr PAV_r1.0chr3
Pos (Chr) 789308
PAV_r1.0 Pav_sc0000158.1
Pos (PAV_r1.0) 8382
REF C
ALT T
SSR motif
Gene Name Pav_sc0000158.1_g020.1.mk
Annotation PREDICTED: putative pentatricopeptide repeat-containing protein At1g16830
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-560+18C>T
Amino Acid
PCR Forward primer ATCAGCTGCCTTTTTCTGGA
Reverse primer ATCGATCGTCATCCCTTTTG
Product size 235
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |