Cherry SNP DataBase

SNP information

Name Pav_sc0000168.1_53461W
Chr PAV_r1.0chr6
Pos (Chr) 10025397
PAV_r1.0 Pav_sc0000168.1
Pos (PAV_r1.0) 53461
REF T
ALT A
SSR motif
Gene Name Pav_sc0000168.1_g110.1.mk
Annotation PREDICTED: NAC domain-containing protein 90
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*169A>T
Amino Acid
PCR Forward primer AAGTCAACAGGCCATGGTTC
Reverse primer CCATTTGAGGAAGCAAGCAT
Product size 263
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |