Cherry SNP DataBase

SNP information

Name Pav_sc0000169.1_12996M
Chr PAV_r1.0chr4
Pos (Chr) 27266937
PAV_r1.0 Pav_sc0000169.1
Pos (PAV_r1.0) 12996
REF C
ALT A
SSR motif
Gene Name Pav_sc0000169.1_g030.1.mk
Annotation PREDICTED: chloride channel protein CLC-c-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.336-44G>T
Amino Acid
PCR Forward primer AAGTAAGATTTTGGCCGCAG
Reverse primer TCTCGTGGATAAGGTCATTCG
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |