Cherry SNP DataBase

SNP information

Name Pav_sc0000170.1_126440K
Chr PAV_r1.0chr2
Pos (Chr) 2256498
PAV_r1.0 Pav_sc0000170.1
Pos (PAV_r1.0) 126440
REF T
ALT G
SSR motif
Gene Name Pav_sc0000170.1_g250.1.mk
Annotation PREDICTED: uncharacterized protein LOC103342793
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*797+65T>G
Amino Acid
PCR Forward primer CTCTCGAATCATTTGCCGTT
Reverse primer AAATGAGGCATCGCATTCTC
Product size 282
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/REF


| Top |