Cherry SNP DataBase

SNP information

Name Pav_sc0000175.1_269401R
Chr PAV_r1.0chr8
Pos (Chr) 8175614
PAV_r1.0 Pav_sc0000175.1
Pos (PAV_r1.0) 269401
REF G
ALT A
SSR motif
Gene Name Pav_sc0000175.1_g530.1.mk
Annotation PREDICTED: protein FMP32, mitochondrial
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*14C>T
Amino Acid
PCR Forward primer CTCAAATATGGCAAAGGGGA
Reverse primer TTGGAAGCTGCAAAGTACGA
Product size 310
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/REF


| Top |