Cherry SNP DataBase

SNP information

Name Pav_sc0000183.1_103826M
Chr PAV_r1.0chr3
Pos (Chr) 5972280
PAV_r1.0 Pav_sc0000183.1
Pos (PAV_r1.0) 103826
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.103826A>C
Amino Acid
PCR Forward primer ATTTCCACTTCAACCAGCCA
Reverse primer GAGTCGGACTTGGGTTTCAA
Product size 306
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT REF/ALT


| Top |