Cherry SNP DataBase

SNP information

Name Pav_sc0000200.1_109839W
Chr PAV_r1.0chr2
Pos (Chr) 12542717
PAV_r1.0 Pav_sc0000200.1
Pos (PAV_r1.0) 109839
REF T
ALT A
SSR motif
Gene Name Pav_sc0000200.1_g150.1.br
Annotation PREDICTED: uncharacterized protein LOC103331624
snpEff Effect synonymous_variant
Impact LOW
Codon c.516T>A
Amino Acid p.Ser172Ser
PCR Forward primer GCGAGTTTGGTCCATCGTAT
Reverse primer GTGGTGATGGTGCATTGAAG
Product size 327
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |